Discussing the Semester and Creating a Plan, Creating Primers

    This semester I am still continuing work with the AMC (activated methyl cycle). This project has been continued from the 2023 spring semester, through the summer and fall semesters. While the experiment has changed throughout the semesters the core of the project has remained the same: looking at the gene expression change after oxidative stress in a species within the Deinococcus genus. 

    This semester I am taking a step back from the main AMC project, and instead focusing on a different gene (metK) within the cycle. While this is still very similar to the main project is covers a different gene and does not go The goal of this project is to develop a verified procedure using E.coli, see metK's response to UV exposure within Deinococcus caeni, and have a poster for this seasons conferences. The reason we are looking into E.coli at the beginning instead of going straight into D.caeni is so that we can verify/validate our qPCR techniques on a on-experimental organism as well as work out issues with out RNA isolation and cDNA conversions. First we are looking at LexA to make sure it is being challenged by the UV exposure then moving on to the experimental MetK. Then when those both are done doing the same LexA the MetK process on our experimental bacteria.



    
    One of the first steps in this plan is to create the primers for the genes we want to look at in  E. coli. In order to do this we need to go to uniprot before searching for e.coli k12 and our gene, then go to the KEGG in databases and copying the NT sequence. After that putting the sequence into the IDT real-time qPCR system and adjusting the parameters in order to find our primers.

    For the primers we have a few rules
1. 18-27 base pairs in length
2. GC% of 40-60%
3. the 3' must end in G (for a GC clamp)
4. a temp form 58°C to 62°C

You also want your product to be between 200 and 700 base pairs. 

In the end I got the primers forward and reverse complimentary for MetK, MetH, pfs, LuxS, and RecA for E.coli k12. Unfortunately transcription regulator LexA and LexA repressor both only had KEGG syn files, which IDT didn’t let me process so i was unable to get those. While it was simple near the end it still took quite a bit of time to learn how to do all the steps and parameter adjustments each time as well as checking through and verifying them by hand. Over all i believe that the next time i do it it will be much easier as this has already taught me how to do it quite well.


MetK

Forward- AGAGATCACCCGTAACACCGTTCGC

Rev. comp- AGTTGCGTAGCCAAACATCAGACCCTG 


MetH

Forward-CGTGCAGGAAGTCGAAGCCAG

Rev. Comp-CGGATTCAGCGTTTTCTCGGCG


pfs

Forward-TGTACGTGGCCTGATTGTTAG

Rev. Comp-GAAGTTGTGGCGGATTTTCG


LuxS

Forward-TGGAAAGCGGCAATGGAAGACG

Rev. Comp-TGCAACTTCTCTTTCGGCAGTGC


RecA

Forward-GGTGAAAGAGGGCGAAAACGTGG

Rev.comp-TCTCACCTTTGTAGCTGTACCACGC



    

Comments

Popular posts from this blog

Reviewing Sequencing Procedure

Touchdown PCR, Nanodroping and Gels

RNA Isolation