Discussing the Semester and Creating a Plan, Creating Primers

    This semester I am still continuing work with the AMC (activated methyl cycle). This project has been continued from the 2023 spring semester, through the summer and fall semesters. While the experiment has changed throughout the semesters the core of the project has remained the same: looking at the gene expression change after oxidative stress in a species within the Deinococcus genus. 

    This semester I am taking a step back from the main AMC project, and instead focusing on a different gene (metK) within the cycle. While this is still very similar to the main project is covers a different gene and does not go The goal of this project is to develop a verified procedure using E.coli, see metK's response to UV exposure within Deinococcus caeni, and have a poster for this seasons conferences. The reason we are looking into E.coli at the beginning instead of going straight into D.caeni is so that we can verify/validate our qPCR techniques on a on-experimental organism as well as work out issues with out RNA isolation and cDNA conversions. First we are looking at LexA to make sure it is being challenged by the UV exposure then moving on to the experimental MetK. Then when those both are done doing the same LexA the MetK process on our experimental bacteria.



    
    One of the first steps in this plan is to create the primers for the genes we want to look at in  E. coli. In order to do this we need to go to uniprot before searching for e.coli k12 and our gene, then go to the KEGG in databases and copying the NT sequence. After that putting the sequence into the IDT real-time qPCR system and adjusting the parameters in order to find our primers.

    For the primers we have a few rules
1. 18-27 base pairs in length
2. GC% of 40-60%
3. the 3' must end in G (for a GC clamp)
4. a temp form 58°C to 62°C

You also want your product to be between 200 and 700 base pairs. 

In the end I got the primers forward and reverse complimentary for MetK, MetH, pfs, LuxS, and RecA for E.coli k12. Unfortunately transcription regulator LexA and LexA repressor both only had KEGG syn files, which IDT didn’t let me process so i was unable to get those. While it was simple near the end it still took quite a bit of time to learn how to do all the steps and parameter adjustments each time as well as checking through and verifying them by hand. Over all i believe that the next time i do it it will be much easier as this has already taught me how to do it quite well.


MetK

Forward- AGAGATCACCCGTAACACCGTTCGC

Rev. comp- AGTTGCGTAGCCAAACATCAGACCCTG 


MetH

Forward-CGTGCAGGAAGTCGAAGCCAG

Rev. Comp-CGGATTCAGCGTTTTCTCGGCG


pfs

Forward-TGTACGTGGCCTGATTGTTAG

Rev. Comp-GAAGTTGTGGCGGATTTTCG


LuxS

Forward-TGGAAAGCGGCAATGGAAGACG

Rev. Comp-TGCAACTTCTCTTTCGGCAGTGC


RecA

Forward-GGTGAAAGAGGGCGAAAACGTGG

Rev.comp-TCTCACCTTTGTAGCTGTACCACGC



    

Comments

Post a Comment

Popular posts from this blog

Summary of 'the effect of magnetic field on the activity of superoxide dismutase'

  Magnetic fields are created when electrons spin. Normally electrons are paired, and if they spin in opposite directions from magnetic fields cancel out. However in free radicals the electron sometimes are unpaired or a pair electrons spin in the same direction, in this case the magnetic fields are not cancelled out. Most enzymes are not affected by these magnetic fields, however some are. This experiment is to determine the amount of effect of a magnetic field on the enzyme known as superoxide dismutase aka SOD.   SOD is a catalyst that catalyzes the conversion of superoxide free radicals into O2 and H2O2. This experiment was to study the influence of magnetic fields on SOD activity, to see how it would affect biological processes. They tested this by exposing SOD to EMF for various amounts of time then measuring its activity by measuring its reaction to oxygen. To conduct the experiment, the SOD enzyme was combined with Na2CO3, methionine, NBT, EDTA, PBS, dH20 and riboflavin Sol
Read more

Aquaticus Lyse

Image
      In the last blog I mentioned moving onto another project with Kieran, trying to replicate a D.rad lyse onto aquaticus. Before I could start with the procedures I had to make the solutions and create the protocols. It was a lot of dilutions and changing the pH of things, but I also had to make an EDTA solution.       To make the multibuffer I would need, I started by making 100 ml of 50 mM sucrose, and 100 ml of 10 mM tris-HCL. After making those two solutions, I made 100 ml of .5 M, pH 8.0 EDTA. While it was simple enough to combine the ingredients (18.61 g disodium EDTA- 2 H2O and 80 ml water), I then had to change the pH. The original pH was around 3.4, so it took a while, dosing it with HCl to raise the pH and cause the solids to dissolv e. After the EDTA was diluting the 10% Triton x-100 to .1%, which was done when creating the multibuffer. I ended up making 100 ml of multibuffer, with 8 ml of the EDTA solutiom, 5 ml of the sucrose, 1 ml of the 10x Triton x-100, 1 ml of the
Read more

Linear Plasmids, Restriction Enzyme Ligation and Plasmid Extractions

Image
  Linear Plasmids, Restriction Enzyme Ligation, and Plasmid Extractions   The project I’m currently working on is linear plasmids. We’re trying to take a plasmid from E.coli that contains a gene called tet that codes for tetracycline (an antibiotic) resistance, and remove D.rad’s (Deinococcus Radiodurans) lux.s gene before incorporating tet into the spot in D.rads genes where lux used to be.   On Monday we decided to separate into two groups and try two different methods of removing the lux and replacing it with tet. While the other group will be doing the original overlap PCR, our group will be trying restriction enzyme ligation. Both groups will be performing the same basics, but going about the process in different ways. In the end we’re just trying to find which process is more reliable and efficient.   Before we could start doing restriction enzyme ligation, we needed to create more plasmids, as the various experiments over the week have depleted our supply. Using New
Read more